| Types | DnaRegion
|
| Roles | promoter
Regulatory
|
| Sequences | BBa_K1722000_sequence (Version 1)
|
Description
Uroplakin II (UPII) has been characterized as a bladder tissue-specific protein and the expression of uroplakin II was found to be limited to bladder-derived cells.
2015 SZU-iGEM use hUPII to drive the expression of the therapeutic genes(such as p21 and Bax) so that the gene is expressed only in bladder cells and systematic toxicity is minimized.
We tested hUPII gene in HFC(Human Fiber Epithelial Cells),5637,T24 and Hela cell lines and found it can confer preferential expression of genes in the bladder urothelium like HFC, which are normal bladder cells, 5637 and T24, which are bladder cancer cells.
Notes
We designed the following primers and amplified hUPII promoter from the vector psi-Check2:
CCGGAATTCATCGGGTGATCAGTACTCC
TGCACTGCAGACTAGTACTGAGCTGTGAGGT
By incorporating these primers into hUPII promoter, the promoter is flanked by the iGEM prefix and suffix after amplification.
Source
hUPII gene was achieved from Shenzhen Second People's Hospital. We read a scientific treatise talking about targeted therapy of bladder cancer written by a doctor in Shenzhen Second People's Hospital and tried to seek cooperation with them. Fortunately, they agree to provide us hUPII with psi-Check2 as its vector.