Types | DnaRegion
|
Roles | DNA
sequence_feature
|
Sequences | BBa_K1722005_sequence (Version 1)
|
Description
Rluc can express Renilla luciferase which has become popular as a reporter enzyme for gene expression assays. Renilla luciferase (RLUC)is a blue-light emitting luciferase of marine anthozoan Renilla reniformis [Str].As a reporter gene, rescarchers attach it to a regulatory sequence of another gene of interest in bacteria, cell culture, animals or plants. RLUC is chosen as a reporter because the characteristic it confer on organisms expressing it is easily identified and measured.The bioluminescence of the sea pancy,is under the control of a nerve network and is stimlated by changes of intracellular Ca??﹢ concerntramide,CO₂ andlight(λMax=480nm),as in the following scheme.
RLBP is another protein of Renilla reniformis that can luminesce in vivo called Ca??﹢???triggered Renilla luciferin birding protein.
2015 SZU-IGEM construct Rluc with one codon being amber mutated and SV40 ,the promoter in the same plasmid to introduce Rluc into our system.This plasmid with Rluc,together with two other plasmids,are inserted into the cell.Only when the two promoters in plasmids without Rluc are activated simultanuously to express the downstrean DNA sequence can Rluc being translated completely. RLUC that is produced inside the cell catalyzes a reaction with luciferin to produce light. By measuring the light intensity using Luminometer,we can tell the working efficiency of our system under different conditions.
Notes
We designed the following primers and amplified Rluc promoter from the vector psi-Check2:Up: CCGGAATTCTCTAGACTGGCTGCCAAGTAGTAC Down: TGCACTGCAGACTAGTTACTGCTCGTTCTT. By incorporating these primers into Rluc promoter, the promoter is flanked by the iGEM prefix and suffix after amplification.
Source
In our experiment, we got the part from Shenzhen Second People's Hospital. Additionally, we did our system's function verification in Shenzhen Second People's Hospital.