Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Zongxiao He, Hao Jiang
Date created: 2009-07-02 11:00:00
Date modified: 2015-07-09 11:37:13
lacZalpha-ccdB coding sequence
| Types | DnaRegion |
| Roles | CDS Coding |
| Sequences | BBa_K176003_sequence (Version 1) |
Description
A fusion protein of lacZalpha(I732006) and ccdB(K145151). It should have the function of ccdB to cause E. coli cells to die, but have less toxicity because of the lacZalpha part. It should also have the function of lacZalpha as a reporter for measurement. This part is similar to J32026 but the multiple cloning sites are eliminated. It is constructed by PCR from the plasmid pluxCcdB3(a gift from Prof. Lingchong You).Notes
The part is similar to BBa_J32026 and the original coding sequence in pluxCcdB3, but the multiple cloning sites are eliminated in order to avoid site-specific mutagenesis. The multiple cloning sites are from lacZalpha in pZErO-2.After eliminate the MCS, the lacZalpha part is identical to the N-terminal of the wild type gene(BBa_I732006 & BBa_I732005), and fused with the ccdB part (BBa_K145151) with a 3aa linker.
Source
PCR from the plasmid pluxCcdB3(a gift from Prof. Lingchong You).Forward Primer: GTTTCT TCTAG ATG accatgattacgg attcactggccgtcgttttac
Reverse Primer: GTTTCTTC CTGCAG CGGCCGC T ACTAGT A TTATTA tattccccagaacatcaggtta
Digest with XbaI and SpeI, ligate into pSB1A3.
| Sequence Annotation | Location | Component / Role(s) |
| a part of lacZalpha (I732006) Start 177bp and a in J32026 M13 -20 primer M13 -47 primer (K176059) M13 -40 primer g and 69bp in I732006 at in K145151 ccdB (K145151) c in K145151 Stop VRccdB primer (K176058) lacZalpha-ccdB | 1,165 1,3 16,16 21,37 41,64 41,57 165,165 172,173 172,477 255,255 475,480 188,215 1,474 | feature/BioBrick engineered_region feature/start start_codon sequence_alteration feature/mutation feature/primer_binding primer_binding_site feature/primer_binding primer_binding_site feature/primer_binding primer_binding_site point_mutation feature/s_mutation sequence_alteration feature/mutation feature/BioBrick engineered_region point_mutation feature/s_mutation feature/stop stop_codon feature/primer_binding primer_binding_site CDS feature/cds |