Types | DnaRegion
|
Roles | Coding
CDS
|
Sequences | BBa_K1766014_sequence (Version 1)
|
Description
EnvZ is part of the EnvZ-OmpR two-component regulatory system for controlling osmotic pressure in E.coli. Structure includes the EnvZ247 allele [1] which is linked through a GGSSAAG linker to a V5 epitope tag. The full structure has a predicted size of 115.36 kDa [2]. The part was provided in the pRD400 (or pEnvZ) backbone under a lac-inducible promoter [3].
Two-component regulatory systems are a common in procaryotes for signal transduction through the membrane. In this case, EnvZ is activated by changes in osmotic pressure leading to phosphorylation of the kinase. The response regulator OmpR is then activated throungh phosphorylation resultning in the regulation of expression of the outer membrane porin proteins OmpF and OmpC.
Notes
Illegal restirction site EcorI present in original sequence at 315-321 bp. Site-directed mutagenesis, exchanging A317G, was appempted using primers F1 and R1 but was unsuccesful.
F1: cactatgagttcttaagccatcagatggcgc
R1: gcgccatctgatggcttaagaactcatagtg
Source
EnvZ was isolated from E.coli K12.