Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Andrew D Halleran, Joseph L Maniaci
Date created: 2015-09-16 11:00:00
Date modified: 2015-09-17 09:41:10
R0062 gRNA under R0040
| Types | DnaRegion |
| Roles | Composite engineered_region |
| Sequences | BBa_K1795004_sequence (Version 1) |
Description
This sgRNA sequence was designed to target the Promoter Bba_R0062 with the N20 sequence tacaggtttacgcaagaaaa . If this gRNA is expressed in a cell with a form of the dCas9 protein, the protein will be targeted to the N20 sequence and repress gene expression. The part is under the control of the promoter Bba_R0040. Promoter Bba_R0040 was chosen because it does not contain a PAM and therefore cannot be inadvertently repressed by dCas9 due to unintentional homology in the N20 sequence. Expression of this part can be repressed if TetR is expressed in the cell without Tetracycline present. If TetR and Tetracycline (or its analog aTc) are both present, the part will be expressed.Notes
We made sure to use a different promoter for this part than the one which the part targets.Source
The basic template for the sgRNA sequence was taken from the supplementary information of Qi LS, Larson MH, Gilbert LA, et al. Repurposing CRISPR as an RNA-Guided Platform for Sequence-Specific Control of Gene Expression. Cell. 2013;152(5):1173-1183. doi:10.1016/j.cell.2013.02.022.| Access | Instance | Definition |
| public public public public | BBa_R0040 BBa_K1795104 BBa_K1795100 BBa_B0015 | p(tetR) BBa_K1795104 BBa_K1795100 BBa_B0015 |
| Sequence Annotation | Location | Component / Role(s) |
| BBa_R0040 BBa_K1795104 BBa_K1795100 BBa_B0015 | 1,54 55,74 75,156 157,285 | p(tetR) BBa_K1795104 BBa_K1795100 BBa_B0015 |