Types | DnaRegion
|
Roles | Device
engineered_region
|
Description
This part contains a sgRNA which we designed to be expressed in procaryotic organism. There is a promoter in fron of it and a terminator behind.Compared to Part:BBa_K1796203, this part contains a certain crRNA targetted on pyruvate dehydrogenase (PDH) complex E1. So we can use this part to knockout E1 in procaryotic organism with CAS9 by the way of CRISPR. The constitutive promoter and the terminator are based on biobricks BBa_J23100 and BBa_B0012, respectively. To make these two parts more compatible with our sgRNA, we made some modifications on them. For the promoter, we changed -10 box into TATAAT, aiming at higher efficiency of transcription. What???s more, only the core domain of terminator B0012 which can form hairpin structure and oligo U were chosen. We have to make the part a short one to avoid undesired situations, for example, the sgRNA is too long to combine with Cas9 protein.
According to the iGEM team of Freiburg University 2013 project, the sequence of crRNA and tracrRNA are shown as below:
crRNA: gttttagagctatgctgttttgaatggtcccaaaacgggt (repeat1) cttcgagaagac (cutting site) gttttagagctatgctgttttgaatggtcccaaaactttttctagcgc ( repeat2)
tracrRNA :ttggaaccattcaaaacagcatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc (core domain) ttttttttggc
To construct a universal part, we referred to the 2013 project of Freiburg iGEM team and added a BbsI restriction site to the sequence of crRNA by which any required target sequence can be inserted. sgRNA is the recombination of crRNA and tracrRNA. In reference of other articles, the sequence of sgRNA is shown as below:
sgRNA: ca
tttagagcta (part of repeat2) gaaa (a linker between crRNA and tracrRNA) tagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggca ccgagtcggtgc (main trunk of tracrRNA) tttttt (oligo U assist to terminate transcrption)
To standardize this sgRNA, we added prefix and suffix as well as modified promoter BBa_j23100 and terminator BBa_B0012
In order to knock out PDH efficiently,we targeted the conserved domains of this complex:
Notes
According to the iGEM team of Freiburg University 2013 project, the sequence of crRNA and tracrRNA are shown as below:
crRNA: gttttagagctatgctgttttgaatggtcccaaaacgggt (repeat1) cttcgagaagac (cutting site) gttttagagctatgctgttttgaatggtcccaaaactttttctagcgc ( repeat2)
tracrRNA :ttggaaccattcaaaacagcatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc (core domain) ttttttttggc
To construct a universal part, we referred to the 2013 project of Freiburg iGEM team and added a BbsI restriction site to the sequence of crRNA by which any required target sequence can be inserted. sgRNA is the recombination of crRNA and tracrRNA. In reference of other articles, the sequence of sgRNA is shown as below:
sgRNA: ca
tttagagcta (part of repeat2) gaaa (a linker between crRNA and tracrRNA) tagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggca ccgagtcggtgc (main trunk of tracrRNA) tttttt (oligo U assist to terminate transcrption)
To standardize this sgRNA, we added prefix and suffix as well as modified promoter BBa_j23100 and terminator BBa_B0012
Source
none