Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Konstantin Borisov
Date created: 2015-09-15 11:00:00
Date modified: 2015-09-16 08:05:28
Repressible E. coli promoter as annealed oligos
| Types | DnaRegion |
| Roles | promoter Regulatory |
| Sequences | BBa_K1833998_sequence (Version 1) |
Description
This is a part used as a building block for E. coli driven expression that is repressible by a synthetic protein (for more information visit 2015.igem.org/Team:Pitt). In our project, we used this promoter to detect proteases that could cleave the synthetic repressor, and so we named the promoter "pProt". This part uses a special cloning method with the following synthesized nucleotides:pProtsense: aattcgcggccgcttctagattgacaaacaagatatcttaaatgaaaatacaagaaatcttaaatata
pProtantisense: ctagtatatttaagatttcttgtattttcatttaagatatcttgtttgtcaatctagaagcggccgcg
The following method can be used to insert pProt before a desired Biobrick part (which should contain an RBS at minimum and preferably a cds and terminator):
1. Cut the desired plasmid with EcoRI and XbaI. Purify the plasmid with a method of your choice (both gel purification and PCR purification kits from Qiagen serve to remove the short undesired oligonucleotide from the digestion).
2. Be sure that your oligos have 5' phosphorylation (treat unphosphorylated oligos with T4 Polynucleotide Kinase). Then, anneal the two oligos by slowly cooling from 98C to room temperature.
3. Finally, ligate the cut plasmid with the annealed oligos by using a 1:10 molar ratio of plasmid to insert.
4. Transform the ligation reaction into E. coli, and plate.
5. Pick colonies, and verify the success of the cloning with sequencing or PCR. (Doing a diagnostic digest is not recommended as the size of the original plasmid and the desired plasmid are very similar.)
6. Add a composite part to the iGEM registry by using this part with the original protein coding part, checking the box to create without a scar, as this part contains a modified scar.
Notes
When ligating with a cut plasmid, this leaves a modified Biobrick scar between the pProt promoter and original Biobrick part.Source
Synthesized oligonucleotides as described on main page.| Sequence Annotation | Location | Component / Role(s) |
| pProt Oligo scar | 1,47 48,53 | feature/promoter promoter feature/scar |