Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Konstantin Borisov
Date created: 2015-09-14 11:00:00
Date modified: 2015-09-16 07:58:33
T7 promoter as annealed oligos
| Types | DnaRegion |
| Roles | Regulatory promoter |
| Sequences | BBa_K1833999_sequence (Version 1) |
Description
This is a part used as a building block for T7 driven expression. However, this part uses a special method with the following synthesized nucleotides:pT7sense: aattcgcggccgcttctagataatacgactcactatagggagaa
pT7antisense: ctagttctccctatagtgagtcgtattatctagaagcggccgcg
The following method can be used to insert a T7 promoter before a desired Biobrick part:
1. Cut the desired plasmid (which should contain an RBS and cds at minimum) with EcoRI and XbaI. Purify the plasmid with a method of your choice (both gel purification and PCR purification kits from Qiagen serve to remove the short undesired oligonucleotide from the digestion).
2. Be sure that your oligos have 5' phosphorylation (treat unphosphorylated oligos with T4 Polynucleotide Kinase). Then, anneal the two oligos by slowly cooling from 98C to room temperature.
3. Finally, ligate the cut plasmid with the annealed oligos by using a 1:10 molar ratio of plasmid to insert.
4. Transform the ligation reaction into E. coli, and plate.
5. Pick colonies, and verify the success of the cloning with sequencing or PCR. (Doing a diagnostic digest is not recommended as the size of the original plasmid and the desired plasmid are very similar.)
6. Add a composite part to the iGEM registry by using this part with the original protein coding part.
Notes
When ligating with a cut plasmid, this leaves a Biobrick scar between the T7 promoter and original Biobrick part.Source
Synthesized oligonucleotides as described on main page.| Sequence Annotation | Location | Component / Role(s) |
| pT7 Oligo scar | 1,23 24,29 | feature/promoter promoter feature/scar |