Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Jeffrey Marano
Date created: 2016-10-10 11:00:00
Date modified: 2016-10-11 06:00:36
This operator, when paired with a guide RNA, expresses GFP.
| Types | DnaRegion |
| Roles | engineered_region Composite |
| Sequences | BBa_K1875014_sequence (Version 1) |
Description
Single OperatorThe BostonU 2016 iGEM team set out to design a set of mutually orthogonal guide RNA (gRNA) expressing and guide RNA operator pairs that could activate the expression of a gene of interest. This part contains target sequence for g3 from BostonU???s Gemini Library (AATGAACCTATTCGTACCGT).As figure 1 indicates, the introduction of the gRNA leads to a several fold increase in expression in comparison to the basal level without the gRNA. The matrix, figure 2, illustrates the results from a mutual orthogonality screen showing on target and off target expression levels among the guide expression vectors and the guide operator vectors in our system . The results from this experiment show that there is no significant expression among off target pairs, demonstrating that there is no cross talk in Gemini.
Notes
Insert LaterSource
See basic parts pages that make up this part for sources| Access | Instance | Definition |
| public public public public public | BBa_K1875004 BBa_K1875000 BBa_K1875001 BBa_K1875003 BBa_K1875002 | BBa_K1875004 BBa_K1875000 BBa_K1875001 BBa_K1875003 BBa_K1875002 |
| Sequence Annotation | Location | Component / Role(s) |
| BBa_K1875004 BBa_K1875000 BBa_K1875001 BBa_K1875003 BBa_K1875002 | 1,23 32,101 110,118 125,844 853,1388 | BBa_K1875004 BBa_K1875000 BBa_K1875001 BBa_K1875003 BBa_K1875002 |