Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Jeffrey Marano
Date created: 2016-10-10 11:00:00
Date modified: 2016-10-11 06:22:00
This operator, when paired with a guide RNA, expresses GFP.
| Types | DnaRegion |
| Roles | Composite engineered_region |
| Sequences | BBa_K1875017_sequence (Version 1) |
Description
Double OperatorThe BostonU 2016 iGEM team???s Gemini Library contains analog parts in addition to their digital parts. They synthesized multimerized binding sites to increase the expression of the operator. This hypothesis was supported by analogous results in previous synthetic transcriptional regulator research. A multimerized operator means that there are consecutive operators upstream of the promoter where the dCas9-VPR and guide RNA will bind to. In addition to multimerizing operator sites, BostonU 2016 also modulated the space between the binding sites. The graph below demonstrates a screen with this multimerized operator containing the target for g13 from the Gemini Library (guide sequence: GTTCTAAACGTTGGTCCGTC). BostonU 2016 chose to submit the strongest of its double multimerized operators which had a 24 base pair spacer between the operators.
Notes
Insert LaterSource
See basic parts pages for sources of this plasmid| Access | Instance | Definition |
| public public public public public | BBa_K1875008 BBa_K1875000 BBa_K1875001 BBa_K1875003 BBa_K1875002 | BBa_K1875008 BBa_K1875000 BBa_K1875001 BBa_K1875003 BBa_K1875002 |
| Sequence Annotation | Location | Component / Role(s) |
| BBa_K1875008 BBa_K1875000 BBa_K1875001 BBa_K1875003 BBa_K1875002 | 1,70 79,148 157,165 172,891 900,1435 | BBa_K1875008 BBa_K1875000 BBa_K1875001 BBa_K1875003 BBa_K1875002 |