Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Xinyi Liu
Date created: 2016-10-08 11:00:00
Date modified: 2016-10-18 10:57:50
A cyclic promoter of Ki-67 from human genome
| Types | DnaRegion |
| Roles | engineered_region Project |
| Sequences | BBa_K1926002_sequence (Version 1) |
Description
This part is a cyclic promoter named Ki67 from human genome. It can lead to transcription of the downstream DNA sequence once in every G1 phase[3].3. Pei, D.S., et al., Analysis of human Ki-67 gene promoter and identification of the Sp1 binding sites for Ki-67 transcription. Tumour Biol, 2012. 33(1): p. 257-66.
You may use this part to:
1) Express something in mammal cell lines particularly in G1 phases or once in every cell cycle by stable transfecting it into cell line;
2) Use it as a human promoter by transient transfecting it into cells.
Notes
Mutation to remove Pst1Source
The sequence was retrieved from Addgene. We got it from human genome through PCR using the following primers:pKi67-F: ACCTCTGCCCTCCGCCAGCCG
pKi67-R: ACCCGGTGGCCCTACAGGCTACG
(Product: 360)