BBa_K2009233

BBa_K2009233 Version 1

Component

Source: http://parts.igem.org/Part:BBa_K2009233

Generated By: https://synbiohub.org/public/igem/igem2sbol/1

Created by: Chengle Zhang

Date created: 2016-09-13 11:00:00

Date modified: 2016-09-17 07:40:25

SUP35+AD

Details

• Types: DnaRegion
• Roles: CDS; Coding
• Sequences: BBa_K2009233_sequence (Version 1)

Description

introduction
We construted this part as a component of our Propri-ontein system.

This composite part is contructed by ligating SUP35NM gene and the gene of the activating domain of the GAL4 transcription factor.

GAL4 can activate the GAL1 promoter. When GAL4 binds the UAS region, which is on the upstream of the GAL1 promoter, the gene downstream can be expressed. In Yeast-Two-Hybrid (Y2H), GAL4 is divided into two domains, the activating domain (AD) and the binding domain (BD).

The SUP35NM gene we used is provided by Dong Men, PhD of Wuhan Insititue of Virology of Chinese Academy of Sciences, so that the sequence is not quite the same as the existing sequence in the Parts Registry, for a lot of mutations have been done. The standardization of this gene is did by ourselves by adding the Biobrick prefix and suffix to its ends and doing a site mutation to eliminate the PstI cutting site inside it.

sequence
ATGGGCGATTCAAACCAAGGCAACAATCAGCAAAACTACCAGCAATACAGCCAGAACGGTAACCAACAACAAGGTAACAACAGATACCAAGGTTATCAAGCTTACAATGCTCAAGCCCAACCTGCCGGTGGGTACTACCAAAATTACCAAGGTTATTCTGGGTACCAACAAGGTGGCTATCAACAGTACAATCCTCAAGGCGGTTATCAGCAGCAATTCAATCCACAAGGTGGCCGTGGAAATTACAAAAACTTCAACTACAATAACAGTTTGCAAGGATATCAAGCTGGTTTCCAACCACAGTCTCAAGGTATGTCTTTGAACGACTTTCAAAAGCAACAAAAGCAGGCCGCTCCCAAACCAAAGAAGACTTTGAAGCTTGTCTCCAGTTCCGGTATCAAGTTGGCCAATGCTACCAAGAAGGTTGACACAAAACCTGCCGAATCTGATAAGAAAGAGGAAGAGAAGTCTGCTGAAACCAAAGAACCAACTAAAGAGCCAACAAAGGTCGAAGAACCAGTTAAAAAGGAGGAGAAACCAGTCCAGACTGAAGAAAAGAAGGAGGAAAAATCGGAACTTCCAAAGGTAGAAGACCTTAAAATCTCTGAATCAACAGATAATACCAACAATGCCAATGTTACCAGTGCTGATGCCTTGATCAAGGAACAGGAAGAAGAAGTGGATGACGAAGTTGTTAACGATTACTACATGGCCAATTTTAATCAAAGTGGGAATATTGCTGATAGCTCATTGTCCTTCACTTTCACTAACAGTAGCAACGGTCCGAACCTCATAACAACTCAAACAAATTCTCAAGCGCTTTCACAACCAATTGCCTCCTCTAACGTTCATGATAACTTCATGAATAATGAAATCACGGCTAGTAAAATTGATGATGGTAATAATTCAAAACCACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGCGTTTGGAATCACTACAGGGATGTTTAATACCACTACAATGGATGATGTATATAACTATCTATTCGATGATGAAGATACCCCACCAAACCCAAAAAAAGAGTAG
(All the sequence has been testified by Sangon)

Notes

the sequence is not quite the same as the existing sequence in the Parts Registry, for a lot of mutations have been done. The standardization of this gene is did by ourselves by adding the Biobrick prefix and suffix to its ends and doing a site mutation to eliminate the PstI cutting site inside it

Source

The SUP35NM gene we used is provided by Dong Men, PhD of Wuhan Insititue of Virology of Chinese Academy of Sciences

Other Properties

• igem#experience: None
• igem#status: Planning
• synbiohub#ownedBy: user/james
• synbiohub#ownedBy: user/myers
• synbiohub#topLevel: BBa_K2009233/1

Member of these Collections

• iGEM Parts Registry