BBa_K2009363

BBa_K2009363 Version 1

Component

Source: http://parts.igem.org/Part:BBa_K2009363

Generated By: https://synbiohub.org/public/igem/igem2sbol/1

Created by: Chengle Zhang

Date created: 2016-09-13 11:00:00

Date modified: 2016-09-17 07:36:55

PGAL+GFP

Details

• Types: DnaRegion
• Roles: engineered_region; Reporter
• Sequences: BBa_K2009363_sequence (Version 1)

Description

introduction
This part is designed as a reporter in the Propri-ontein system of Team USTC 2016.

We construted this composite parts by ligating two former existing parts and doing a site mutation. The two parts we used is (1) GAL1 promoter Kozak sequence (Part:BBa_J63006) and (2) GFP (Part:BBa_E0040).

The GAL1 promoter is activated by the trancription factor GAL4. When GAL4 binds the UAS region, which is on the upstream of the GAL1 promoter, the gene downstream can be expressed. In Yeast-Two-Hybrid (Y2H), GAL4 is divided into two domains, the activating domain (AD) and the binding domain (BD).

The designer of Part:BBa_J63006 is very thoughtful for adding the KOZAK sequence to the downstream of the GAL1 promoter. Apparently, they meaned to improve the effeiciency of this part. However, considering the existence of the Biobrick prefix, the ATG inside the KOZAK sequence won't be in the same reading frame as the ATG of the downstream coding sequence. There were two teams managed to fix this problem, with the idea to eliminate the ATG inside the KOZAK sequence. This year, we applyed a different idea. We added one base pair between those two ATGs and made them belong to one common frame. Meanwhile, another ATG is made up between the former ones, belonging to the same frame.

sequence
CGGATTAGAAGCCGCCGAGCGGGTGACAGCCCTCCGAAGGAAGACTCTCCTCCGTGCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACTAGCTTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATGAACGAATCAAATTAACAACCATAGGATGATAATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAACAGATATATAAATGCAAAAACTGCATAACCACTTTAACTAATACTTTCAACATTTTCGGTTTGTATTACTTCTTATTCAAATGTAATAAAAGTATCAACAAAAAATTGTTAATATACCTCTATACTTTAACGTCAAGGAGGAAACTAGACCCGCCGCCACCATGGAGACTATGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAA
(All the sequence has been testified by Sangon)

Notes

The designer of Part:BBa_J63006 is very thoughtful for adding the KOZAK sequence to the downstream of the GAL1 promoter. Apparently, they meaned to improve the effeiciency of this part. However, considering the existence of the Biobrick prefix, the ATG inside the KOZAK sequence won't be in the same reading frame as the ATG of the downstream coding sequence. There were two teams managed to fix this problem, with the idea to eliminate the ATG inside the KOZAK sequence. This year, we applyed a different idea. We added one base pair between those two ATGs and made them belong to one common frame. Meanwhile, another ATG is made up between the former ones, belonging to the same frame.

Source

We construted this composite parts by ligating two former existing parts and doing a site mutation. The two parts we used is (1) GAL1 promoter Kozak sequence (Part:BBa_J63006) and (2) GFP (Part:BBa_E0040).

Other Properties

• igem#experience: None
• igem#status: Planning
• synbiohub#ownedBy: user/james
• synbiohub#ownedBy: user/myers
• synbiohub#topLevel: BBa_K2009363/1

Member of these Collections

• iGEM Parts Registry