Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Yin Wu
Date created: 2016-09-13 11:00:00
Date modified: 2016-09-17 07:37:40
sfGFP11 with promoter and RBS
| Types | DnaRegion |
| Roles | Composite engineered_region |
| Sequences | BBa_K2009602_sequence (Version 1) |
Description
sfGFP11 length: 112bpDerived from:synthesis from Sangon
BBa_J23100: promoter:
BBa_B0030: RBS
sfGFP11??????PSB1C3 is an expression plasmid which insert sfGFP11 into PSB1C3.
before sfGFP11, we add a linker(gatggagggtctggtggcggatca) to achieve our goal.SfGFP11 is a part of GFP(from 214bp to 230bp), GFP has been mutated to improve its solubilityand self-associating activity. When it express, it will emit green fluorescenceslightly under the fluorescence microscope.
We try to find anideal protein tag to be work both invivo and invitro and it can provide a sensitive measurable signalwhich don???t need external chemical reagents or substrates. Finally we find away to accomplish this goal?????? dividing GFP into sfGFP1-10and sfGFP11. Either the sfGFP1-10 or sfGFP11 will emit green fluorescence slightly under the fluorescencemicroscope. However, when sfGFP1-10 and sfGFP11 express insame cell, they will interact each other and emit more intense fluorescence thaneach of them. The split GFP system is simple and does not change fusion proteinsolubility.
Usage and biology:The split GFP system has manypractical applications. Obtaining soluble, well-folded recombinant proteins fordownstream applications requires screening large numbers of protein variants (mutants,fragments, fusion tags, folding partners) and testing many expression orrefolding conditions.(Ste??phanieCabantous, Thomas C Terwilliger & Geoffrey S Waldo,2005)
Part sequence
ttgacggctagctcagtcctaggtacagtgctagctactagagattaaagaggagaaatactagagagaccacatggtccttcatgagtatgtaaatgctgctgggattaca
(All the sequence has been testified by Sangon)
Notes
If we PCR from GFP directly, we have to mutate it many times and it is more convenient to directly synthese it.Source
chenical synthesis and link it to BBa_K081005| Access | Instance | Definition |
| public public | BBa_K081005 BBa_K2009820 | BBa_K081005 sfGFP11 |
| Sequence Annotation | Location | Component / Role(s) |
| BBa_K081005 BBa_K2009820 | 1,58 67,114 | BBa_K081005 sfGFP11 |