| Types | DnaRegion
|
| Roles | Coding
CDS
|
| Sequences | BBa_K2022012_sequence (Version 1)
|
Description
A commonly used reporter is Green Fluorescent Protein (GFP) (BBa_E0040). Here, we have fused it to the C-terminus of the Ice Nucleation Protein, N- and C-termini (BBa_K811005), which is a well-characterised membrane anchor. As such, this part is intended to function like GFP, but simply localised to the membrane of cells
Notes
Pennsylvania (2012) designed their INPNC part with the BamHI site, to make it readily fusible to other proteins; we thank them for their contribution in making the assembly and design processes as simple as possible.
As such, the only design consideration was to use the oligonucleotide aggcggatccggtatgcgtaaaggagaagaacttttcactg to add a BamHI site upstream of the GFP open reading frame
Source
To make this part, we combined BBa_K811005 (INPNC) with BBa_E0040 (GFP).
First, we digested BBa_K811005 with BamHI and PstI.
Then, we PCR amplified BBa_E0040 using Suffix-R2, and a forward oligonucleotides that replaced the prefix with a BamHI site (aggcggatccggtatgcgtaaaggagaagaacttttcactg). This PCR product was then also digested with BamHI and PstI.
These two products were then ligated together, and transformed into E. coli host (DH5-alpha derivative)