enhanced

BBa_K2075011 Version 1

Component

This part has been discontinued.

Source: http://parts.igem.org/Part:BBa_K2075011

Generated By: https://synbiohub.org/public/igem/igem2sbol/1

Created by: Kim Luehmann

Date created: 2016-10-13 11:00:00

Date modified: 2016-10-15 02:58:28

enhanced Green fluorescenc protein (GFP)

Details

• Types: DnaRegion
• Roles: CDS; Coding
• Sequences: BBa_K2075011_sequence (Version 1)

Description

The eGFP is a part which synthesize a green fluorescence protein (GFP). Exposed under blue or UV light it emits a bright green light. The enhanced GFP (eGFP) has a higher intensity emission than the wildtyp GFP. The origin of the GFP is the jellyfish Aequorea victoria. Today the GFP is an essential fluorescence reporter protein for biologie especially cellbiologie. It can be connect to other proteins to detect the expression of these proteins and their location.
We used the eGFP to detect our TAL effectors on a chip, spotted with oligonucleotides. these oligonucleotides includes the target sequenz of the TALE Hax3 ??? 2xNN (A C A C C C G/A G/A ? C A).

Notes

No considerations

Source

atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaag

Sequence Annotations

Sequence Annotation	Location	Component / Role(s)
eGFP	1,717	CDS, feature/cds

Other Properties

• igem#experience: Works
• igem#status: Deleted
• synbiohub#ownedBy: user/james
• synbiohub#ownedBy: user/myers
• synbiohub#topLevel: BBa_K2075011/1

Member of these Collections

• iGEM Parts Registry