Types | DnaRegion
|
Roles | Regulatory
promoter
|
Sequences | BBa_K248000_sequence (Version 1)
|
Description
This part consists in the promoter of the alkaline phosphatase of Escherichia coli. It contains the phoB box sequence (ctgtcataaagttgtcacggcc), recognized by the phosphorilated transcriptional regulator phoB and activated under low extracellular phosphate concentrations.
Notes
The main problem of this part is its short length: only 91 bp because it is the space between the end of the previous ORF and the beginning of the encoding region of PhoA.
Source
This part comes from the genome of a DH5a strain of E. coli.