cry11Aa

BBa_K332011 Version 1

Component

Source:
http://parts.igem.org/Part:BBa_K332011
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Chia-Le Meng
Date created: 2010-10-23 11:00:00
Date modified: 2015-05-08 01:12:05

Crystal protein gene (cry11Aa) from Bacillus thuringiensis subsp. Israelensis.



Types
DnaRegion

Roles
Coding

CDS

Sequences BBa_K332011_sequence (Version 1)

Description

The cry weapon system produce crystal protein, targetting the wrigglers, larvae of mosquitoes. The cry11Aa gene is cloned from Bacillus thuringiensis subsp. Israelensis. The cry protein is controlled by the tetR-repressible promoter PtetR (BBa_R0040), which in turn is regulated by a temperature control system. When E.coli is released into environment (<37C), tetR begins to degrade, resulting in the promoter PtetR (BBa_R0011) expressing downstream genes, cry11Aa (BBa_K332012) and Green Fluorescent Protein (GFP)(BBa_E0040).

Notes

Procedures

(I) Culture Bti.
Bacillus thuringiensis subsp. Israelensis (BCRC15860)
1. Prepare agar plate for Bti.
Beef extract 3.0g
Peptone 5.0g
Agar 15.0g
ddH2O 1 L



*adjust PH to 7.0
*No antibiotic
*Be aware of contamination
2. Plate Bti. on the medium and incubate the cultures at 30??C overnight.
(II) Clone cry11Aa from Bti. into TA vector
1. Extract genomic DNA of Bti. by liquid nitrogen.
2. Add some ddH2O to dilute the DNA.
3. Design primers
Vf2: ATTCAATAAAAGGTGGAATGAATTATGGA Tm: 53??C
VR: GTGCTAACATGACTTCTACTTTAGT Tm: 52.8??C
4. Find the best PCR condition by gradient PCR.
Anneling temperature: 51??C??10??C
5. PCR by B-taq plus on the best condition

Template DNA(10ng/μl) 2.0
B-taq buffer 5.0
dNTP(2mM) 5.0
forward primer(10μM) 1.5
reverse primer(10μM) 1.5
B-taq plus DNA polymerase(2Kb) 1.0
ddH2O 34.0
Total 50 μl

6. Digestion to confirm the cry11Aa fragment and enzyme sites.
7. TA clone
8. DNA sequencing

(III) PCR mutagenesis at two enzyme sites --- EcoR1 and Spe1
1. Design primers by primerX.
EcoR1-Vf2: CGG GTA CAA TCT CAG AAC TCG GGA AAT AAT AGA A
EcoR1-VR: TTC TAT TAT TTC CCG AGT TCT GAG ATT GTA CCC G
Spe1-Vf2: ATA ATG AAT GGG GAG GAC TGG TTT ATA AGT TAT TAA TGG G
Spe1-VR: CTT CCC CCA TTA ATA ACT TAT AAA CTA GTC CTC CCC ATT CAT
2. Digestion to confirm the fragments

(IV) PCR construction of Biobrick parts
1. Design primers by Assembly standard 10.
Vf2: GTTTCTTC GAATTC GCGGCCGC T TCTAG ATGGAAGATAGTTCTTTAGATACT
VR: GTTTCTTC CTGCAG CGGCCGC T ACTAGT A CTACTTTAGTAACGGATT
2. PCR condition
3. Ligation to backbones(Psb1C3).
(V) Transform into E.coli
1. Thaw competent cells and BBa_K332012 plasmid on ice.
2. Add 2ul plasmid to competent cell and place in ice for 5 minutes.
3. Put the transformed cells into 42℃ water bath for 45 seconds.
4. Plate the cells on the appropriate media and antibiotic, such as agar plates with 25 ??g/ml kanamycin.
5. Incubate the cultures at 37??C overnight.
(VI) Culture with mosquito larvae and observe

Source

Crystal protein gene (cry11Aa) from Bacillus thuringiensis subsp. Israelensis.

BCRC Number: 15860
Organism: Bacillus thuringiensis subsp. israelensis de Barjac
History: << ATCC << USDA << ONR 60 << H. de Barjac << L. J. Goldberg 60
Other Collection No.: ATCC 35646
Source: sewage, Israel
Characterization: Production of delta-endotoxin against dipteran larvae --B3009
Others: referred to as the type strain --B3008
Growth Conditions: 30??C , Medium ID: 3
Oxygen Requirement: Aerobic
Biosafety Level: 1

References:

Temeyer, K. B. 1984. Larvicidal activity of Bacillus thuringiensis subsp. israelensis in the dipteran Haematobia irritans. Appl. Environ. Microbiol.47 : 952-955.
PMID: 6742837.

Demezas, D. H. and J. Bell. 1995. Evaluation of low molecular weight RNA profiles and ribotyping to differentiate some Bacillus species. Syst. Appl. Microbiol.18 : 582-589.

igem#experience Works  
igem#sampleStatus It's complicated  
igem#status Planning  
rdf-schema#seeAlso P21256  
synbiohub#ownedBy user/james  
synbiohub#ownedBy user/myers  
synbiohub#topLevel BBa_K332011/1