Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: iGEM11_UNAM-Genomics_ Mexico
Date created: 2011-09-24 11:00:00
Date modified: 2015-05-08 01:12:36
NifH promoter -> Rhizobium etli
| Types | DnaRegion |
| Roles | promoter Regulatory |
| Sequences | BBa_K535004_sequence (Version 1) |
Description
This is the promoter region of one of the three nitrogenase reductase gene copies in Rhizobium etli, nitrogenase reductase a (nifHa). This region comprises a σ54-dependent promoter located between position -24 and -12 relative to the transcription start site, as well as a binding site for NifA, a positive transcriptional regulator [1]. NifA is a member of the enhancer-binding protein (EBP) family of transcriptional regulators that activate gene expression in concert with RNA polymerase containing the specialized σ54 sigma factor (RpoN) to allow the polymerase core to recognize the -24/-12 promoter [3] in response to oxygen and/or fixed nitrogen levels. The binding site for NifA is located ~200 bp upstream of the transcription start site [2].Activation of gene expression by NifA (along with the specialized sigma factor σ54) occurs only at low oxygen concentrations [2]. In R. etli, the nifA gene is located on the symbiotic plasmid [4]. This promoter region, in addition to other similar promoter regions ensure the expression of the nitrogen fixation apparatus during symbiosis of the bacteroid with its legume host [3].
We decided to use this promoter region in our project to promote the transcription of gene constructions that, according to our design, need to be expressed in low oxygen conditions in R. etli. The genes regulated by this promoter region will generally be active in the bacteroid state of R. etli because there are low concentrations of oxygen in the nodule???s environment.
Notes
This regulatory sequence was amplified by PCR using the genome of R. etli strain CFN42 as template DNA. The oligos used to amplify the promoter region from the mentioned genome are the following: Upper primer: this primer contains the prefix sequence along with the first 25 nt of the promoter region.CGGAATTCGCGGCCGCTTCTAGAGCGACACCGTCTGTCGGCTTTGTCTG
Lower primer: this primer contains the suffix sequence along with the last 24 nt of the promoter region (they do not include the RBS we used in our design).
AACTGCAGCGGCCGCTACTAGTATCTTTCGTTCCATCCATCGCTGAG
*and has no modifications according to the reported sequence by Emmanuel Salazar, 2010.
Source
This is the upstream regulatory sequence of the nifHa gene in Rhizobium etli, which encodes a nitrogenase reductase. The R. etli nifHa gene is located on the symbiotic plasmid p42d, which is a circular molecule of 371, 255 bp that has the repABC type of replicator. There are three copies of the nitrogenase reductase genes in this plasmid: nifHa, nifHb and nifHc. The nifHa and nifHb copies are transcriptionally coupled to nitrogenase structural genes, forming the nifHDK operons [2]. The nifHc copy is linked to a truncated nifD homolog. A remarkable difference among them is the absence of canonical NifA binding sites upstream nifHc while a canonical binding site is located 200 bp upstream of nifHa and nifHb.| Sequence Annotation | Location | Component / Role(s) |
| nifH promoter Enhancer binding site -24/-12 box | 1,203 19,35 125,141 | feature/promoter promoter feature/binding non_covalent_binding_site feature/misc sequence_feature |