Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Yinghong Lan
Date created: 2011-10-01 11:00:00
Date modified: 2015-05-08 01:12:41
Aptamer-CheZ: theophylline-sensitive synthetic riboswitch+phosphatase which dephosphorylates CheY-P
| Types | DnaRegion |
| Roles | engineered_region Translational_Unit |
| Sequences | BBa_K557001_sequence (Version 1) |
Description
This part is composed of a theophylline-sensitive aptamer,which will pair the ribosome binding site of the downstream gene in the absence of theophylline and thus inhibit the translation of the gene while expose the ribosome binding site in the presence of theophylline, and the CheZ gene, which is a phosphatase which dephosphorylates CheY-P and causes the flagellum to rotate counterclockwise and is essential for keeping the motility of E.coli. Thus this part provides a ligand-inducible motility and makes it possible to guide E.coli by theophylline.Notes
We found the sequence of this part in literature and tried to design primers to construct it. But we were faced with a challenging problem in primer design, which comes from the basic properties of the aptamer involved. The aptamer tends to pair the ribosome binding site in the absence of theophylline, which is true in PCR, and enables primers to pair to the corresponding parts and the new strand to elongate. We made contact with the author of our reference and found they took different strategies in assembling the aptamer to CheZ instead of PCR. But thanks to the warm help of Professor J. S. Parkinson and Professor J. P. Gallivan, we acquired the sequence of primers used in assembling the aptamer to another gene and designed our own after analyzing them:forward primer:5'-GTTTCGAATTCGCGGCCGCTTCTAGGGTGATACCAGCATCGTCTTGATGCCCTTGGCAGCACCCCGCTGCAAGACAACAAG ATGCAACCATCAATCAAACC-3'
reverse primer:5'-GTTTCCTGCAGCGGCCGCTACTAGTATTATTAAAATCCAAGACTATCCAACAAATCGT-3'
Besides, we used special protocal of PCR:
96℃ 10min
96℃ 30s, 56℃ 30s, 72℃ 1min for 16 cycles and each cycle the annealing temperature increases by 1℃
96℃ 30s, 72℃ 30s, 72℃ 1min for 20 cycles
72℃ 10min