Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Saisi Xue
Date created: 2011-09-26 11:00:00
Date modified: 2015-05-08 01:12:42
pDAL7(malate synthase promoter)
| Types | DnaRegion |
| Roles | promoter Regulatory |
| Sequences | BBa_K563001_sequence (Version 1) |
Description
DAL7 encodes malate synthase in yeast, whose role in allantoin degradation unknown. Its expression is sensitive to nitrogen catabolite repression and induced by allophanate, an intermediate in allantoin degradation. Evidence showed that DAL7 has transcriptional response to nitrogen availability through the two transcription factors GLN3 and GAT1, for the expression of DAL7 is obviously induced in gln3Δ???gat1Δ strain. Therefore, it is predicted that DAL7 is under control of a promoter which is sensitive to transcription factor GLN3 and GAT1. When TORC1 is inhibited by FAP, dephosphorylated GLN3 and GAT1 would bind with pDAL7 and activate downstream genes. We put the target gene of mutant Tor2 under this promoter, and then its expression could be controlled by the amount of FAP and the activity of TORC1. Mutant Tor2 would be much resistant to FAP and a feedback loop is formed between FAP, TORC1, GLN3 and GAT1 and mTor.Notes
In order to determine the appropriate assembly standard which the part can be used with, it's necessary to check the sequence for each of the restriction enzymes. Sequence scanning of pDAL7 show that no EcoRI XhoI XbaI SpeI NcoI PstI BamHI exists. As our target gene comes from yeast and contains common restriction sites like EcoRI, NotI and SpeI, the stantard BioBrick prefix and suffix is no longer appropriate. Furthermore, the size of 7800bp makes it pretty expensive and inconvenient for chemical synthesis and codon optimization to avoid certain restriction sites. To match with the operation of downstream gene, the promoter parts also give up standard prefix and suffix. However, based on the modified plasmid backbone pSB1A11, we bring in some other common restriction sites, which also render functionality and ease-of-use of promoter parts.Source
We isolate the sequece by PCR on Saccharomyces cerevisiae strain BY4742. For standard operation of BioBricks and easy-use for other teams, we add restriction sites at upstream and downstream of the sequence ( NcoI and XhoI respectively) by designing specific primers (details in sequence and feature annotations).Forward Primer(with restriction site and protective bases): (TCATGCCATGG)TACCTGGCATGCGCCCATGATAGTAC
Reverse Primer(with restriction site and protective bases): (ATCCGCTCGAG)TGTTCAGTGCTCTTTACCGTGCCTAT
| Sequence Annotation | Location | Component / Role(s) |
| DAL7 Promoter NcoI+fwd primer XhoI+rev primer | 12,508 1,37 484,520 | feature/promoter promoter feature/primer_binding primer_binding_site primer_binding_site feature/primer_binding |