Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Kousik Sundararajan
Date created: 2011-10-02 11:00:00
Date modified: 2015-05-08 01:12:44
Mouse Beta Carotene Dioxygenase
| Types | DnaRegion |
| Roles | CDS Coding |
| Sequences | BBa_K572009_sequence (Version 1) |
Description
..Notes
Forward Primer :5???TTTACTACGAATTCGCGGCCGCTTCTAGATGGAGATAATATTTG 3???
Reverse Primer :
5???AATCGAACctgcagcggccgctactagtaTTAAAGACTTGAG 3???
Polymerase Chain reactions didn't work for a long time at various temperature conditions. Finally, increasing Magnesium Sulphate in the reaction resulted in bringing about the amplification. The following is the optimized PCR Setup :
Template (116 ng/ul) = 0.25 ul
10mM dNTP = 1.0 ul
10x Pfu Buffer (without Magnesium Sulphate) = 2.0 ul
+ Primer (10 uM) = 1.0 ul
- Primer (10 uM) = 1.0 ul
Magnesium Sulphate - final concentration of 2.5 - 3 mM
Pfu Pol = 1.25 u
Nuclease Free Water - make the volume to 20ul
Source
Source Organism : Marine gamma proteobacterium EBAC31A08.We would like to thank Kwang-Hwan "Kevin" Jung, Ph.D., Associate Professor, Department of Life Science and Institute of Biological Interfaces, Sogang University, Korea for sending us the plasmid (pKJ900) with dioxygenase gene.
| Sequence Annotation | Location | Component / Role(s) |
| Start Codon Bc_dioxygenase Stop Codon | 1,3 1,1701 1699,1701 | start_codon feature/start CDS feature/protein feature/stop stop_codon |