Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: iGEM11 Potsdam_Bioware
Date created: 2011-09-20 11:00:00
Date modified: 2015-05-08 01:12:56
Fusion part of mdnA gene (from mdn-cluster) with myc-tag and gene III
| Types | DnaRegion |
| Roles | CDS Coding |
| Sequences | BBa_K627006_sequence (Version 1) |
Description
An appropriate vector containing the biobrick mdnA-myc-geneIII-fusion gene is a very important milestone of the development of a functional phage display system for screening of a microviridin (mdnA) library. Microviridins are tricyclic peptides from cyanocacteria which are able to bind and inhibit proteases. The gene III protein is a coat protein from the filamentous bacteriophage M13. It appears only 3-5 times on the tip of the phage and is responsible for infection of bacterial cells. After transformation of E. coli with the vector and co-infection with helper phages E. coli cells are able to produce phage particles carrying microviridin on their surface. Using these phages the fundamental suitability of phage display as a screening method for mdnA varieties was indicated. This has great importance for identifying microviridin varieties of therapeutical relevance. The inserted myc sequence enables the easy detection or purification . In our project the successful expression of the mdnA-myc -gene-III-fusion protein was determined by ELISA. Subsequent the production of phages carrying mdnA in E. coli was analyzed by phage display.Notes
Gene III was amplified from the vector pak100 bla KDIR using the following primerForward:TAAGCTTCTAGATGGCCGGCGAGCAGAAGCTGATCTCTGAGGAAGACCTGGGTGGTGGCTCTGGTTCC
Reverse: TGCTTAGACGTCCTGCAGCGGCCGCTACTAGTATTAACCGGTAGACTCCTTATTACGCAGTA
The mdnA gene was amplified from the vector pARW089 using the following primer
Forward: TTCCATGGCGCCAGAGGAATCTAGATGGCATATCCCAACGATC
Reverse: CTTCTGACTGGGAAGATTATACCGGTTAATACTAGTAGCGGCCGCTGCAGGACGTC
Gene III was amplified from pak100blaKDIR and mdnA from pARW089 by PCR. The primers were designed to enable the introduction of iGEM. The PCR product gene III was digested by whereas the PCR product mdnA was digested by AgeI. Thus a mdnA-gene III fusion part according to RFC25 was generated whereby AgeI and NgoMIV overhangs are compatible and placed in frame with the protein sequence. The ligation of AgeI and NgoMIV overhangs resulted in a scar coding for the threonine and glycine. Because the introduction of restriction sites before mdnA leaded to a great distance between ribosome binding site and mdnA a second RBS was inserted among SfoI and XbaI recognition sites to ensure a sufficiently expression rate of the mdnA-geneIII-fusion gene. Between mdnA and gene III myc sequence was inserted.
Because this BioBrick is an expression part, the adenin of mdnA gene start codon is part of the XbaI recognition site. Further the sequence contains a AgeI recognition site after gene III.
Source
The BioBrick mdnA is a part of the microviridin gene (mdn) cluster which was isolated from Microcystis aeruginosa strain NIES-843.| Sequence Annotation | Location | Component / Role(s) |
| mdnA myc gene III (sequence coding for C-terminal domain) ligation scar (NgoMIV+AgeI) | 1,149 156,185 186,656 150,155 | CDS feature/cds tag feature/tag CDS feature/cds sequence_feature feature/misc |