Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Jara Radeck
Date created: 2013-10-15 11:00:00
Date modified: 2015-05-08 01:13:30
pSB1C3F-Vector pSB1C3 with RFP-cassette in Freiburg Standard
| Types | DnaRegion |
| Roles | Plasmid_Backbone plasmid_vector |
| Sequences | BBa_K823055_sequence (Version 1) |
Description
To allow the possibility to save some nucleotides of primer-overhangs, you can use this vector. The two AgeI-restriction sites from the original RFP-cassette have been removed. The cassette is flanked by the modified Freiburg standard (http://2012.igem.org/wiki/images/b/b9/LMU-Munich_2012_Our_Freiburg_standard_FusionPrefix.pdf) that includes an optimal ribosome binding site between XbaI and NgoMIV restriction sites.Notes
Two AgeI-restriction sites have been removed by two subsequent quikchange site-directed mutagnesis reactions. The RFP-cassette was PCR-amplified with the overhangs:prefix: GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC
suffix: ACCGGTTAATACTAGTAGCGGCCGCTGCAGT
Source
pSB1C3; the RFP-part is originally from Discosoma sp.| Sequence Annotation | Location | Component / Role(s) |
| cat ori (pMB1) | 1169,1828 260,874 | CDS feature/cds feature/misc sequence_feature |