| Types | DnaRegion
|
| Roles | CDS
Coding
|
| Sequences | BBa_K929001_sequence (Version 1)
|
Description
The BioBrick wtAID is an improved version of the existing AID BioBrick (BBa_K103001). It has no NES(Nuclear Export Sequence) sequence and has NLS (Nuclear Localization Sequence) sequence and Kozak sequence added
The AID motif is naturally terminated with the Nuclear Export Sequence (NES) that causes the protein to translocate from the nucleus to the cytoplasm. Additionally, upstream, dysfunctional Nuclear Localization Sequence (NLS) is located. Due to the fact that AID mutates the actively transcribed single stranded DNA, it is supposed that the direction of the enzyme to the inside of the nucleus would improve the mutation rate.
AID:
AID is known to be responsible for somatic hypermutation and the class-switch recombination of immunoglobulin in B cells. This enzyme of 28 kDa originally occurs in B cells but does also show activity after transfection into CHO cells. AID induces the deamination of cytidine to uridine at actively transcribed single strand DNA. The replacement of cytidine by uridine leads to a mismatch during DNA replication and integrates a single base substitution predominantly in the immunoglobulin genes.
Functional NLS sequence:
This part of the BioBrick directs the expressed protein into the nucleus, where it can mutate stronger.
Kozak sequence
Kozak consensus sequence is added upstream of the AID mutant to express the protein stronger.
Notes
Primer (forward) with XbaI recognition site, kozak consensus sequence, NLS:
ATCTAGAGCCGCCACCATGGGACCCAAGAAGAGGAAGGTGATGGACAGCCTCTTGATGAACCGGAGG
Primer (reverse, complement)with AgeI, SpeI and PstI recognition site:
GCCTGCAGCGGCCGCTACTAGTATTAACCGGTGGGCAAAAGGATGCGCCGAAGC
[[Image: UP12_biobrick1.jpg]]
Source
AID BioBrick (BBa_K103001) and self-designed primers