Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Tom Knight
Date created: 2006-03-16 12:00:00
Date modified: 2015-05-08 01:14:12
gentamycin resistance cassette (aacC1 gene)
| Types | DnaRegion |
| Roles | Generator engineered_region |
| Sequences | BBa_P1013_sequence (Version 1) |
Description
The aacC1 gene conveys resistance to gentamycin only. It is derived from a Tn21 series transposon (Wohlleben89) found on the R1033 plasmid (Pseudomonas aeruginosa). This part is created by PCR from the pJAT8 plasmid (Keastling lab) which in turn is derived from pJN105 (Newman and Fuqua).Notes
pJAT8 plasmid edited with primers:
GTT TCT TCG AAT TCG CGG CCG CTT CTA GAG ccttgtcgccttgcgtataa,aacC1-F
GTT TCT TCC TGC AGC GGC CGC TAC TAG TA atctcggcttgaacgaattg,aacC1-R
| Sequence Annotation | Location | Component / Role(s) |
| -35 / -10 promoter sites aacC1 coding sequence RBS | 71,99 288,821 276,279 | promoter feature/promoter CDS feature/cds feature/rbs ribosome_entry_site |