Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Julia Preziosi
Date created: 2015-07-06 11:00:00
Date modified: 2015-08-31 04:08:24
Xanthine Aptamer from riboCalc with RS3, riboswitch in tCloneRed
| Types | DnaRegion |
| Roles | engineered_region Device |
| Sequences | BBa_J100222_sequence (Version 1) |
Description
This part comes from the combination of a xanthine aptamer, as determined by the Riboswitch Calculator, with part of "Riboswitch 3" from Wachsmuth (the sequence minus its aptamer) to make a new riboswitch. This riboswitch was inserted into tCloneRed, and functions to express the reporter gene, RFP, when in the presence of its ligand, xanthine.Notes
We had to add the aptamer to a riboswitch so that we could get the selective termination via the stem-loop behavior. We therefore did't know how the total riboswitch would fold or if it would be a successful riboswitch.Aptamer alone = GGCACGUGUAUUACCCUAGUGGUCGACGUGCC
Source
tCloneRed = BBa_J119361Riboswitch 3 = J100207; Wachsmuth et al. 2013, available from http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3575828/ .
| Sequence Annotation | Location | Component / Role(s) |
| P5 promoter BD 18 C dog RBS Xanthine Riboswitch RFP | 1,36 116,200 41,111 201,881 | feature/promoter promoter feature/rbs ribosome_entry_site feature/stem_loop stem_loop feature/cds CDS |