Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Lydia Soifer
Date created: 2016-09-07 11:00:00
Date modified: 2016-09-08 08:11:24
lysine regulated promoter
| Types | DnaRegion |
| Roles | Regulatory promoter |
| Sequences | BBa_J100299_sequence (Version 1) |
Description
This promoter includes the -91 to -81 regions directly upstream of the -35 to 0 region in addition to the sticky ends for BsaI.Top1- 5' CGACTTTCACTGATATGGCGGCGTAGCGATGCGCTGGTTACTCTGAAAACG
Bot1- 5' CGCCCGTTTTCAGAGTAACCAGCGCATCGCTACGCCGCCATATCAGTGAAA
The -81 to -118 region is known to be a binding sight for lysine repression of the promoter (Bouvier, Jean, et. al 2008). If this whole region is not needed for lysine binding and the lysine will still bind if the binding sight is located directly upstream of the -35 region, the promoter should be activated in the absence of lysine and repressed in the presence of lysine.
Notes
See description.Source
This sequence is from E. coli.Bouvier, J., P. Strangler, V. Morales, E. Remy, and C. Gutierrez. "Lysine Represses Transcription of the E. Coli DapB Gene by Preventing Its Activation by the ArgP Activator." Journal of Bacteriology, Aug. 2008. p. 5224-5229.