Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: John Anderson
Date created: 2006-07-30 11:00:00
Date modified: 2015-08-31 02:02:59
EN-Ptet-rbs-X-[GFP]-SNP "ORF Expresser"
| Types | DnaRegion |
| Roles | Plasmid_Backbone plasmid_vector |
| Sequences | BBa_J61003_sequence (Version 1) |
Description
Plasmid for assembly of open reading frame basic parts. A Tet promoter (r0040) and strong ribosome binding site (b0034) lie between the EcoRI and XbaI sites. Insertion of an open reading frame basic part into the XbaI and PstI sites results in constitutive expression but retains basic part utilityin standard assembly.Notes
N/ASource
PCR KB001/ca1021R on pSB1A2-J01022 (250 bp, EcoRI/XbaI)
sub into pSB1A2-E0040(GFP;DNA-1-5H) (EcoRI/XbaI)
Product is pBca1021-E0040
ca1021R Reverse b0034 XbaI
AGCCATCTAGAATTTCTCCTCTTTCTCTAG
KB001 Forward EcoRI to construct Ptet part-making biobrick plasmid
ttctggaattcgcggccgcaactagagccaggcatc
| Sequence Annotation | Location | Component / Role(s) |
| BBa_B0015 (terminator) BBa_R0040 (Ptet) beta-lactamase (ampR) promoter ColE1 origin beta-lactamase (ampicillin resistance marker) rrnB T1 terminator pBR322 BioBrick suffix EcoRI NotI XbaI Verification forward (VF2) primer binding site Verification reverse (VR) primer binding site BBa_B0034 RBS RBS Ptet promoter | 2080,2208 2217,2270 1859,1887 180,862 957,1817 2091,2134 183,802 1,21 2058,2063 2064,2071 2292,2297 1940,1959 79,98 2279,2290 2279,2290 2217,2270 | engineered_region feature/BioBrick engineered_region feature/BioBrick promoter feature/promoter sequence_feature feature/dna CDS feature/cds stem_loop feature/stem_loop sequence_feature feature/dna sequence_feature feature/dna feature/dna sequence_feature feature/dna sequence_feature feature/dna sequence_feature feature/primer_binding primer_binding_site feature/primer_binding primer_binding_site feature/BioBrick engineered_region feature/rbs ribosome_entry_site feature/promoter promoter |