Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Sai Duriseti
Date created: 2007-03-19 12:00:00
Date modified: 2015-05-08 01:08:17
The promoter region (inclusive of regulator binding sites) of the B. subtilis RocDEF operon
| Types | DnaRegion |
| Roles | Regulatory promoter |
| Sequences | BBa_J64804_sequence (Version 1) |
Description
This is the reported promoter region from the Bacillus subtilis RocDEF operon as taken from the DBTBS website (http://dbtbs.hgc.jp/). Base 1 to base 21 contains the binding site for the binding factor, RocR. The sequence, TATGCAAAAGAATTTTGCACT, reportedly contains the consensus sequence for binding of this factor. Base 42 to base 62 contains another binding site for the RocR binding factor, with ATATCAGAATGTTTTTGCACC as the binding consensus for this sequence. Bases 113-135 outline the binding site of the binding factor AhrC (CTTGCATTTATATAAAGGGAAAG). Bases 96 to 135 outline the promoter region for this operon (CTTGATTTGGCACAGAACTTGCATTTATATAAAGGGAAAG).Notes
This sequence only outlines the reported promoter region as ascertained from the online resource described above, and may lack nucleotides not described by the operon analysis used.Source
Information was obtained from: http://dbtbs.hgc.jp/COG/prom/rocDEF.html.| Sequence Annotation | Location | Component / Role(s) |
| RocR Binding Site RocR Binding Site Promoter AhrC | 1,21 42,62 96,135 113,131 | feature/binding non_covalent_binding_site non_covalent_binding_site feature/binding feature/promoter promoter feature/binding non_covalent_binding_site |