| Types | DnaRegion
|
| Roles | CDS
Coding
|
| Sequences | BBa_J70007_sequence (Version 1)
|
Description
recET recombination gene from Spiroplasma citri, probably catalyzing the homologous recombination of DNA fragments similar to the Lambda Bet gene (Lambda RED recombination). This gene is from S. citri, a close relative of Me. florum, and has very similar codon usage.
Notes
Eliminate GATC site by silent mutation to GACC (asp -> asp).
Note very low GC content at the 5' end. The primers are:
* gtttcttcgaattcgcggccgcttctagatgaataataaaattgaattaatattaaataattc,recT-F
* gtttcttctactagtagcggccgctgcagttattaatcagaaaacatttcattaacagc,recT-R
* gaaatgcaagaagcctatcaacatgaccaagcaataattattaataacagc,recT-mut-F
* gctgttattaataattattgcttggtcatgttgataggcttcttgcatttc,recT-mut-R
Source
Genbank entry CAK99381 protein, nucleotide coding region. Mutations of the single GATC site to avoid restriction by the Sau3AI restriction system in Me. florum.
PCR from S. citri DNA, kind gift of Prof. J. Renaudin.