Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Julie Norville
Date created: 2010-05-08 11:00:00
Date modified: 2015-05-08 01:08:24
{15,18
13,10} BsaXI BioScaffold v 5.0, no BsaXI, V169I in E0040
| Types | DnaRegion |
| Roles | Temporary sequence_feature |
| Sequences | BBa_J70575_sequence (Version 1) |
Description
removed the BsaXI site from the R0010 portion of the parta mutation in version J70568 left the red color of E0040, but otherwise was correct, so that is the difference between this and J70568
Notes
this removes BsaXI site from R0010 and incorporates a PCR mutation that occurred when trying to amplify J70568Source
designed (pcr'd from J04450)J70568f:
gtttcttcgaattcgcggccgcttctagagctccgattcattaatgcagctggcacgac
J70568r:
gtttcttcctgcagcggccgctactagtacctgtcctcctataaacgcagaaag
| Sequence Annotation | Location | Component / Role(s) |
| BsaXI partial site (only occurs when follows scar) BsaXI site BsaXI partial site (occurs with suffix or scar) mutation from J70568: G506A (DNA), V169I (protein) R0010(-naturally occurring internal BsaXI site) B0034 E1010 Junk from J04450 BsaXI potential cut site BsaXI cut site BsaXI cut site BsaXI cut site B0010 B0012 | 1,4 795,805 1040,1049 506,506 1,170 178,190 197,877 878,902 12,14 783,785 813,815 1030,1032 911,990 999,1039 | sequence_feature feature/misc sequence_feature feature/misc sequence_feature feature/misc sequence_alteration feature/mutation feature/promoter promoter ribosome_entry_site feature/rbs CDS feature/protein sequence_feature feature/misc sequence_feature feature/misc sequence_feature feature/misc sequence_feature feature/misc feature/misc sequence_feature feature/BioBrick engineered_region engineered_region feature/BioBrick |