Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Burak YILMAZ
Date created: 2008-11-08 12:00:00
Date modified: 2015-05-08 01:09:46
LamB_HP-metal binding domain in LamB-153 residue
| Types | DnaRegion |
| Roles | Coding CDS |
| Sequences | BBa_K129004_sequence (Version 1) |
Description
LamB tolerates insertions of long heterologouspeptides at a permissive loop (between structural codons 153
and 154) exposed to the external medium without a loss of
function.protein. The histidine-rich sequence Gly-His-His-Pro-His-Gly employed in
LamB and called HP. HP represents one to three multiple
repeats along the C-terminal part of the human plasma metal
transport protein known as the histidine rich-glycoprotein(HRG.
The HRG binds heme and various divalent heavy
metal ions with the following apparent order of affinity:
Cu21; Hg21 . Zn21 . Ni21 . Cd21 . Co21 .
The HP sequence is believed to form surface metal binding sites
(MBSs) of HRG, and it has been also successfully used to
immobilize Cu21 and Zn21 on IMAC columns.
Notes
GATCCAGCTGGTCATCATCCACACGGTGCT is inserted in LamB-153 residue because permissive loop (between structural codons 153and 154) can be exposed to the external medium without a loss offunction.
Source
To make HP_LamB GATCCAGCTGGTCATCATCCACACGGTGCT is inserted in LamB protein at 153. aa residue encodes theAla-Gly-His-His-Pro-His-Gly-Ala-C sequence,
so LamB has source and this gene have to be replaced HP domain in 153 residu
DEFINITION E.coli lamB gene fragment.
ACCESSION A31943
VERSION A31943.1 GI:1567229
KEYWORDS .
SOURCE Escherichia coli
ORGANISM Escherichia coli
Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales;
Enterobacteriaceae; Escherichia.