BBa_K1343001

BBa_K1343001 Version 1

Component

Source: http://parts.igem.org/Part:BBa_K1343001

Generated By: https://synbiohub.org/public/igem/igem2sbol/1

Created by: Ronen Ben Jehuda

Date created: 2014-09-21 11:00:00

Date modified: 2015-05-08 01:09:59

P_ompC->NheI->RBS->luxI->double terminator

Details

• Types: DnaRegion
• Roles: engineered_region; Generator
• Sequences: BBa_K1343001_sequence (Version 1)

Description

This part generates AHL (Source organism: V. fischeri).
The promoter is P_ompC which induced by the Taz receptor which is cloned on a different plasmid as a different patr. Before the promoter there is the prefix site and after the promoter there is a restriction site of NheI, so the promoter can be replaced by a restriction enzyme reaction.
In addition, after the NheI restriction site, there is an RBS and luxI which is coding to AHL. At the end of the part, there is double terminator and the Suffix site.

Notes

The part has been sequenced and has been checked with a detector strain which detects AHL and produce color. We know for sure that it produces AHL.

Source

P_ompC: BBa_R0082
RBS: BBa_B0030
luxI: BBa_C0061 but we removed the LVA tag (gctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc) and added stop codon: "tag".
Double terminator BBa_B0015

Sequence Annotations

Sequence Annotation	Location	Component / Role(s)
P_ompC	1,108	feature/promoter, promoter
NehI	109,114	feature/misc, sequence_feature
spacer	115,140	feature/misc, sequence_feature
luxI	141,722	CDS, feature/protein
Double terminator	723,851	sequence_feature, feature/misc

Other Properties

• igem#sampleStatus: It's complicated
• igem#status: Planning
• synbiohub#ownedBy: user/james
• synbiohub#ownedBy: user/myers
• synbiohub#topLevel: BBa_K1343001/1

Member of these Collections

• //function/regulation/transcriptional
• iGEM Parts Registry