| Types | DnaRegion
|
| Roles | engineered_region
Generator
|
| Sequences | BBa_K1343001_sequence (Version 1)
|
Description
This part generates AHL (Source organism: V. fischeri).
The promoter is P_ompC which induced by the Taz receptor which is cloned on a different plasmid as a different patr. Before the promoter there is the prefix site and after the promoter there is a restriction site of NheI, so the promoter can be replaced by a restriction enzyme reaction.
In addition, after the NheI restriction site, there is an RBS and luxI which is coding to AHL. At the end of the part, there is double terminator and the Suffix site.
Notes
The part has been sequenced and has been checked with a detector strain which detects AHL and produce color. We know for sure that it produces AHL.
Source
P_ompC: BBa_R0082
RBS: BBa_B0030
luxI: BBa_C0061 but we removed the LVA tag (gctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc) and added stop codon: "tag".
Double terminator BBa_B0015