Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Mona Dotzler
Date created: 2014-10-04 11:00:00
Date modified: 2015-06-01 12:56:24
Signal peptide of B. subtilis minor autolysin LytE
| Types | DnaRegion |
| Roles | CDS Coding |
| Sequences | BBa_K1351027_sequence (Version 1) |
Description
Signal peptide (amino acids 1 to 25) of Bacillus subtilis minor autolysin LytE (probable peptidoglycan endopeptidase, Uniprot P54421). Targets proteins for secretion via the Sec pathway (Tjalsma et. al., 2000).This part was generated in a modified version of RFC25, where a strong Shine Dalgarno Sequence (SD) is included, and has the following prefix and suffix:
{|
|prefix with EcoRI, NotI, XbaI, SD and NgoMIV:
|GAATTCGCGGCCGCTTCTAGAGTAAGGAGGAGCCGGC
|-
|suffix with AgeI, SpeI, NotI and PstI:
|ACCGGTTAATACTAGTAGCGGCCGCCTGCAG
|}
Sites of restriction enzymes generating compatible overhangs have the same color:
EcoRI and PstI in blue, NotI in green, XbaI and SpeI in red, NgoMIV and AgeI in orange. Shine-Dalgarno sequence and stop codons are underlined.
Notes
noneSource
This part was generated by amplification from BioBrick BBa_K1351007 with the primers listed below, followed by digestion with EcoRI and PstI and ligation into pSB1C3.LytE_ENX_SD_Ngo_fwd: gatcGAATTCgcggccgctTCTAGAgtaaggaggaaGCCGGC ATGAAAAAGCAAATCATTACAGCTACGACAGC
LyteSP_SNP_Age_rev: gatcCTGCAGcggccgctACTAGTattaACCGGT TGCAGATGCCGCTCCTGCAAATAAC