
BBa_K1351028 Version 1


Generated By:
Created by: Florian Riemer
Date created: 2014-10-05 11:00:00
Date modified: 2015-06-01 08:09:54

LMU Bacillus RBS collection 1




Sequences BBa_K1351028_sequence (Version 1)


This part was generated in a modified version of RFC25, and has the following prefix and suffix:
{||prefix with EcoRI, NotI, XbaI, SD and NgoMIV:|GAATTCGCGGCCGCTTCTAGATGGCCGGC|-|suffix with AgeI, SpeI, NotI and PstI:|ACCGGTTAATACTAGTAGCGGCCGCTGCAG|}Sites of restriction enzymes generating compatible overhangs have the same color:
EcoRI and PstI in blue, NotI in green, XbaI and SpeI in red, NgoMIV and AgeI in orange. Stop codons are underlined.


The LMU Bacillus RBS collection is based on a wobble-library with the sequence ARRRRRRGATA and the theoretical translation initiation rates of the RBS in this library, calculated by the salis lab's RBS calculator ( The 7 RBS submitted as BioBricks are the ones that offer the best coverage of translation initiation rate space, 1 being the optimal Bacillus RBS and 7 being the weakest.



igem#sampleStatus In stock  
igem#status Available  
synbiohub#ownedBy user/james  
synbiohub#ownedBy user/myers  
synbiohub#topLevel BBa_K1351028/1