Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Kok-Phen YAN
Date created: 2008-10-24 11:00:00
Date modified: 2015-05-08 01:10:02
flgA promoter followed by its natural RBS
| Types | DnaRegion |
| Roles | Regulatory promoter |
| Sequences | BBa_K136006_sequence (Version 1) |
Description
Promoter of flgA gene from E. coli flagellaflgA is a class 2 gene that is part of the construction of the flagella ( Ordering Genes in a Flagella Pathway by Analysis of Expression Kinetics from Living Bacteria - S. Kalir, J. McClure, K. Pabbaraju, C. Southward, M. Ronen, S. Leibler, M. G. Surette, U. Alon ).
Its promoter is consitutively repressed.
It is activated by FlhD4C2 and maybe by FliA with different strength ( Using a Quantitative Blueprint to Reprogram the Dynamics of the Flagella Gene Network - Shiraz Kalir and Uri Alon ).
Notes
>forward primerGTTTCTTCGAATTCGCGGCCGCTTCTAGAGAGCATATCTCCTCCGCAGGTATCAAAAT
>reverse primer
GTTTCTTCCTGCAGCGGCCGCTACTAGTAACAGTATCGCGATGATCGCCACGCTACGT
Source
This part comes from the genome of E.coli K12 strain MG1655.| Sequence Annotation | Location | Component / Role(s) |
| flhDC binding site flhDC binding site ATG transcription initiation nautral flgA RBS | 63,78 89,104 160,162 138,138 146,154 | feature/binding non_covalent_binding_site non_covalent_binding_site feature/binding feature/start start_codon start_codon feature/start ribosome_entry_site feature/rbs |