Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Exeter iGEM 2015
Date created: 2015-09-09 11:00:00
Date modified: 2015-09-21 06:09:26
Synthetic toehold riboswitch - J23100
| Types | DnaRegion |
| Roles | RNA mature_transcript_region |
| Sequences | BBa_K1586000_sequence (Version 1) |
Description
A toehold switch is a type of RNA molecule known as a riboregulator/riboswitch. It is able to detect the presence of a specific ssRNA molecule (termed the 'trigger RNA') which has a sequence complementary to its switch region through base pairing. If the correct RNA molecule is detected, the protein coding region attached to the toehold switch is expressed.A toehold switch is unique from other types of riboswitches as it is completely synthetic, and therefore easier to engineer and standardise. The fact that the toehold switch can be modified means that the switch region can be changed to detect any given trigger RNA molecule, and the protein coding region can be swapped for any desired reporter protein for easy measurement/visualisation.
Toehold switches can be used to detect specific RNA molecules in a cell-free system, or transformed into cells in order to ascertain whether a gene is being expressed (through detection of its mRNA). The applications of this technology can range from a research tool (e.g. detection of secreted RNA in cell supernatant, detection of gene expression, etc.), through to more commercial/medical applications such as diagnostic testing.
Part K1586000 encodes for a toehold switch forward engineered by Green et al. (2014). This toehold switch is designed to detect a synthetic RNA trigger (GGGACUGACUAUUCUGUGCAAUAGUCAGUAAAGCAGGGAUAAACGAGAUAGAUAAGAUAAGAUAG) and produces GFP when activated. This toehold switch contains non-standard ribosome binding site (RBS) and GFP reporter protein and has an intended use as a control. Part K1586003 encodes a more standardised toehold switch.
Notes
The first 12 nucleotides of the toehold (not including the GGG leader sequence) should not form a part of the toehold stem.The majority of the RBS should be within the loop region of the toehold.
There must not be an inframe stop codon within the main linker sequence.
The linker sequence length must be a multiple of three.
Source
The sequence of this part was designed by and characterised in cells by Green et al. 2014 (http://www.sciencedirect.com/science/article/pii/S0092867414012896; supplementary information, table 3, Forward Engineered Toehold 1).| Sequence Annotation | Location | Component / Role(s) |
| J23100 GGG leader sequence Switch region Protein coding region Terminator GFP Stem-loop ATG Double stop codon (TAA TAA) | 1,33 34,36 37,61 88,884 893,1021 126,884 51,104 93,95 879,884 | promoter feature/promoter feature/misc sequence_feature feature/misc sequence_feature feature/cds CDS feature/misc sequence_feature feature/protein CDS stem_loop feature/stem_loop feature/start start_codon stop_codon feature/stop |