Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Exeter iGEM 2015
Date created: 2015-09-17 11:00:00
Date modified: 2015-09-18 12:22:18
EsxB synthetic toehold switch J23100 STOP
| Types | DnaRegion |
| Roles | RNA mature_transcript_region |
| Sequences | BBa_K1586002_sequence (Version 1) |
Description
Usage and Biology
A toehold switch is a type of RNA molecule known as a riboregulator/riboswitch. It is able to detect the presence of a specific ssRNA molecule (termed the 'trigger RNA') which has a sequence complementary to its switch region through base pairing. If the correct RNA molecule is detected, the protein coding region attached to the toehold switch is expressed.
A toehold switch is unique compared to other types of riboswitches as it is completely synthetic, and therefore easier to engineer and standardise. The fact that the toehold switch can be modified means that the switch region can be changed to detect any given trigger RNA molecule, and the protein coding region can be swapped for any desired reporter protein for easy measurement/visualisation.
Toehold switches can be used to detect specific RNA molecules in a cell-free system, or transformed into cells in order to ascertain whether a gene is being expressed (through detection of its mRNA). The applications of this technology can range from a research tool (e.g. detection of secreted RNA in cell supernatant, detection of gene expression, etc.), through to more commercial/medical applications such as diagnostic testing.
The Part
Part K1586000 encodes for a toehold switch forward engineered by Green et al. (2014), nicknamed GreenFET1 (Green forward engineered toehold). GreenFET1 is designed to detect a synthetic RNA trigger (GGGACUGACUAUUCUGUGCAAUAGUCAGUAAAGCAGGGAUAAACGAGAUAGAUAAGAUAAGAUAG) and produces GFP when activated. It contains non-standard ribosome binding site (RBS) and GFP reporter protein and has an intended use as a control/comparison toehold. For characterisation and use, GreenFET1 has been put under the control of a J23100 promoter. It can also be found under the control of a T7 promoter as part
Characterisation
Notes
The first 12 nucleotides of the toehold (not including the GGG leader sequence) should not form a part of the toehold stem.The majority of the RBS should be within the loop region of the toehold.
There must not be an inframe stop codon within the main linker sequence.
The linker sequence length must be a multiple of three.
For a more in depth explanation, see the design page of our wiki: http://2015.igem.org/Team:Exeter/Toehold_Design
Source
Based on the toehold design by Green et al. 2014.| Sequence Annotation | Location | Component / Role(s) |
| J23100 GGG leader sequence Switch region B0034 Protein coding region GFP (E0040) Terminator TAA | 1,33 34,36 37,61 87,98 102,869 150,869 878,1006 114,116 | promoter feature/promoter feature/misc sequence_feature feature/misc sequence_feature feature/rbs ribosome_entry_site CDS feature/cds CDS feature/protein feature/misc sequence_feature stop_codon feature/stop |