Types | DnaRegion
|
Roles | sequence_feature
DNA
|
Sequences | BBa_K1641011_sequence (Version 1)
|
Description
This is the recognition site of Cre-like recombinase Vika, that is "AATAGGTCTGAGAACGCCCATTCTCAGACGTATT". This recognition site is not homologous with LoxP and hence will not cross-react with Cre or other common recombinases.
Note: The brick sequence starts directly after the XbaI of prefix and ends before SpeI of the Suffix, without the useless bases (G and T respectively) added before and after brick sequence. This deletion do not interfere the usage of the brick.
Notes
Vox, as the RTS of Vika, do not process ATG as unexpected start code, so the original
Source
By de novo synthesis.