Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Isabelle Capell-Hattam
Date created: 2015-08-24 11:00:00
Date modified: 2015-08-25 02:21:08
HCV229E Pseudoknot
| Types | DnaRegion |
| Roles | RNA mature_transcript_region |
| Sequences | BBa_K1677666_sequence (Version 1) |
Description
This is part of the BABS iGEM pseudoknot suite. This pseudoknot can be used for delayed translation of a protein sequence, by slowing the ribosome.Notes
All start codons had to be removed from the pseudoknot.20 base pairs from the viral genome flank either side of the pseudoknot region.
3' flanking sequence AACAGTTATTTAAACGAGTC
5' flanking sequence AGGCTGTAGTGCTGTTGCTA
The actual pseudoknot is:
CGGGGCUCUAGUGCCGCUCGACUAGAGCCCUGUAUUGGUACAGACAUAGAUUACUGUGUCCGUGCAUUUGACGUUUACAAUAAAGAUCCGUCUUUUAUCGGAAAAAAUCUGAAGACCAAUUGUGUGUGCUUCAAGAAUAUAGAUAAGGUUGACGGGUUCUAUAUUGUUAAACGUUGCAAUAAGUCAGUUAAGGACCACGAGCAGUCCUUG
((((((((((((...[[[[[))))))))))))(((((((((.(((((((....))))))).))))....(((((((((((((...(((((((((((((((((.....)))..............((((.........)))))))))))..)))))))....))))).)))))))).))))).......(((((((..]]]]].)))))))
Estimated free energy: -74.29 kcal/mol
Source
Hepatitis C virus 299E| Sequence Annotation | Location | Component / Role(s) |
| 3' Flanking Region 5' Flanking Region HCV229E Pseudoknot | 1,20 244,264 20,244 | feature/misc sequence_feature sequence_feature feature/misc feature/tag tag |