| Types | DnaRegion
|
| Roles | RNA
mature_transcript_region
|
| Sequences | BBa_K1723009_sequence (Version 1)
|
Description
The c3_0 guide RNA (gRNA) consists of the 20 base pair specificity determinent sequence (SDS) c3_0 followed by a gRNA scaffold that stabilizes the RNA complex. The gRNA is flanked by two self-cleaving ribozymes: a Hammerhead Ribozyme and a HDV Ribozyme thus freeing the gRNA from the rest of the RNA transcript. Then, the gRNA can form a complex with dCas9-VP64 (or any other Cas9 mutant). The complex c3_0-dCas9_VP64 will bind to any GTACATACAGTAGGATCCTA sequence in the genome of the host organism situated directly before a PAM sequence (NGG).
Notes
The c3_0 gRNA - dCas9_VP64 complex works as an activator of the RNA polymerase II CYC_0 promoter. The Hammerhead ribozyme - gRNA - HDV rizobyme sequence design allows to express gRNAs using RNA polymerase II, thus making it possible to chain the expression of gRNAs (by activating another RNA polymerase II promoter which can express another gRNA e.g.).
Source
Synthesized