| Types | DnaRegion
|
| Roles | Coding
CDS
|
| Sequences | BBa_K1796008_sequence (Version 1)
|
Description
Function: αsubunits of dinitrogease which also called FeMo protein. NifD encode a metallocluster: FeMo-co, a [Mo-7Fe-9S-C-homocitrate] cluster which serves as the active site of substrate binding and reduction.
We abtained the sequences from genomes of Paenibacillus sp. WLY78. First, we promoted it ourselves(done by Nan Wang and Nannan Xie).Then we sent the sequences to synthesis, but unfortunately, striction enzyme cut site was involved after they promoted it again. But we were not informed of the error in promotion.After several times failed expriments, we found the problem.We tackled them over the matter, mistakes were corrected, but the correct genes can't arrive on time,it can only arrive after the deadline.
Sequence submit is promoted by the synthesis company, containing a PstI in the gene.
The sequence we promoted: CAGGAGGGAGGAATAGGCCAAATGTCTTCTATCGTTGACAAAGGTAAACAGATCGTTGAAGAAATCCTGGAAGTTTACCCGAAAAAAGCTAAAAAAGACCGTACCAAACACTTCGAAATCGCTGACGAAGAACTGGTTAACTGCGGTACCTGCTCTATCAAATCTAACATGAAATCTCGTCCGGGTGTTATGACCGCTCGTGGTTGCGCTTACGCTGGTTCTAAAGGTGTTGTTTGGGGTCCGATCAAAGACATGGTTCACATCTCTCACGGTCCGATCGGTTGCGGTCAGTACTCTTGGGGTACCCGTCGTAACTACGCTAACGGTATCCTGGGTATCGACAACTTCACCGCTATGCAGATCACCTCTAACTTCCAGGAAAAAGACATCGTTTTCGGTGGTGACAAAAAACTGGAAGTTATCTGCCGTGAAATCAAAGAAATGTTCCCGCTGGCTAAAGGTATCTCTGTTCAGTCTGAATGCCCGGTTGGTCTGATCGGTGACGACATCGGTGCTGTTGCTAAAAAAATGACCGAAGAACTGGGTATCCCGGTTATCCCGGTTCGTTGCGAAGGTTTCCGTGGTGTTTCTCAGTCTCTGGGTCACCACATCGCTAACGACGCTATCCGTGACTTCCTGATGGGTCGTCGTGAACTGAAAGAATGCGGTCCGTACGACGTTTCTATCATCGGTGACTACAACATCGGTGGTGACGCTTGGGCTTCTCGTATCCTGCTGGAAGAAATGGGTCTGCGTGTTATCGCTCAGTGGTCTGGTGACGGTACCATCAACGAACTGGGTATCGCTCACAAATCTAAACTGAACCTGATCCACTGCCACCGTTCTATGAACTACATGTGCACCACCATGGAACAGGAATACGGTATCCCGTGGATGGAATACAACTTCTTCGGTCCGACCAAAACCATGGAATCTCTGCGTGCTATCGCTGCTCGTTTCGACGAAACCATCCAGGAAAAATGCGAACAGGTTATCGCTCAGTACATGCCGCAGATGGAAGCTGTTATCCGTAAATACCGTCCGCGTCTGGAAGGTAAAAAAGTTATGCTGCTGATCGGTGGTCTGCGTGCTCGTCACACCATCGGTGCTTACGAAGACCTGGGTATGGAAATCGTTGCTACCGGTTACGAATTTGCTCACAAAGACGACTACGAAAAAACCTTCCCGGACGTTAAAGAAGGTACCATCCTGTACGACGACCCGACCGCTTACGAACTGGAAGAACTGGCTCAGCGTCTGAACATCGACCTGATGGGTGCTGGTGTTAAAGAAAAATACGTTTACCACAAAATGGGTATCCCGTTCCGTCAGATGCACTCTTGGGACTACTCTGGTCCATACCACGGGTTTGACGGCTTCAAGATCTTCGCGCGTGACATGGACATGACCATCAACTCTCCGGTTTGGTCTCTGCTGCCGTCTCGTCAGACCGCTGAAGTTCCGGTTTAATAA
Notes
We abtained the sequences from genomes of Paenibacillus sp. WLY78. First, we promoted it ourselves(done by Nan Wang and Nannan Xie).Then we sent the sequences to synthesis, but unfortunately, striction enzyme cut site was involved after they promoted it again.
But the part can be assembled by gibson assembly,that is what we did.
Source
NifD(BBa_K1796008) is taken from genomic sequence of Paenibacillus sp.WLY78, we apply promotions on the sequences and synthesised it.