Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Yu Luo
Date created: 2015-09-15 11:00:00
Date modified: 2015-09-16 10:21:58
An unloaded sgRNA that contains BbsI cutting site, with a promoter and terminator.
| Types | DnaRegion |
| Roles | engineered_region Device |
| Sequences | BBa_K1796203_sequence (Version 1) |
Description
This part contains a sgRNA which we designed to be expressed in procaryotic organism. There is a promoter in fron of it and a terminator behind.Instead of a certain crRNA, we designed a BbsI cutting site in the middle of the sgRNA, on the place where the crRNA should be. So we can use this part to knockout any sequence as we want in procaryotic organism by the way of CRISPR.Notes
According to the iGEM team of Freiburg University 2013 project, the sequence of crRNA and tracrRNA are shown as below:crRNA: gttttagagctatgctgttttgaatggtcccaaaacgggt (repeat1) cttcgagaagac (cutting site) gttttagagctatgctgttttgaatggtcccaaaactttttctagcgc ( repeat2)
tracrRNA :ttggaaccattcaaaacagcatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc (core domain) ttttttttggc
To construct a universal part, we referred to the 2013 project of Freiburg iGEM team and added a BbsI restriction site to the sequence of crRNA by which any required target sequence can be inserted. sgRNA is the recombination of crRNA and tracrRNA. In reference of other articles, the sequence of sgRNA is shown as below:
sgRNA: ca
ccgagtcggtgc (main trunk of tracrRNA) tttttt (oligo U assist to terminate transcrption)
To standardize this sgRNA, we added prefix and suffix as well as modified promoter BBa_j23100 and terminator BBa_B0012.