| Types | DnaRegion
|
| Roles | Generator
engineered_region
|
| Sequences | BBa_K1875011_sequence (Version 1)
|
Description
Guide RNA g3 Expression Part
This composite part can be used to express a guide RNA (g3) from BostonU 2016???s project Gemini. Specifically, this part expresses g3, a guide RNA that directly recognizes the 20bp target sequence 5??? AATGAACCTATTCGTACCGT 3???. This 20bp target sequence can be found in composite part BBa_K1875003.
We used transient transfection into HEK293FT cells to validate functionality of this part. We co-delivered a plasmid with BBa_K1875000 (this composite part with g3), a plasmid with BBa_K1875003 (the corresponding GFP reporter composite part with g3???s target sequence), and a plasmid expressing dCas9-VPR. We assayed for fluorescence of GFP using flow cytometry. We compared expression levels of GFP both with and without the guide RNA. Our results indicate that there is a low level of expression without g3 and a high level of expression with g3.
Notes
This part produces the guide in BBa_K1875011 and the guide that matches the target sequence on BBa_K1875014
Source
This plasmid was based off of the work by Feng Zhanf at MIT and the x330 plasmid.