Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Jeffrey Marano
Date created: 2016-10-10 11:00:00
Date modified: 2016-10-15 11:43:59
This part produces a guide RNA that pairs with an operator.
| Types | DnaRegion |
| Roles | engineered_region Generator |
| Sequences | BBa_K1875012_sequence (Version 1) |
Description
This composite part can be used to express a guide RNA (g8) from BostonU 2016???s project Gemini. Specifically, this part expresses g8, a guide RNA that directly recognizes the 20bp target sequence 5??? GTTGCGCGTCCGTATCAAGG 3???. This 20bp target sequence can be found in composite part BBa_K1875004.We used transient transfection into HEK293FT cells to validate functionality of this part. We co-delivered a plasmid with BBa_K1875001 (this composite part with g8), a plasmid with BBa_K1875004 (the corresponding GFP reporter composite part with g8???s target sequence), and a plasmid expressing dCas9-VPR. We assayed for fluorescence of GFP using flow cytometry. We compared expression levels of GFP both with and without the guide RNA. Our results indicate that there is a low level of expression without g8 and a high level of expression with g8.