| Types | DnaRegion
|
| Roles | Composite
engineered_region
|
| Sequences | BBa_K1875019_sequence (Version 1)
|
Description
The BostonU 2016 iGEM team???s Gemini Library contains analog parts in addition to their digital parts. They synthesized mutated binding sites to decrease the expression of the operator. This hypothesis was supported by previous research suggesting that a mutated operator reduces the binding affinity of the dCas9-VPR complex. They used two mutation techniques: sequential mutation of a single base in the guide, beginning at the 5??? end, and clustered mutations at either base 1 or base 11. The altered base was determined by whether the base was a purine or a pyrimidine and the complement of the base. If the base was a purine, it was mutated to be a pyrimidine and of the opposite coupled nucleotide (i.e: A <-->C, G<-->T). The graph below demonstrates a screen with this mutated operator containing g13 from the Gemini Library (guide sequence: GTTCTAAACGTTGGTCCGTC). BostonU 2016 chose to submit the mutant operator with mutations at base 10 resulting in a sequence of GTTCTAAACTTTGGTCCGTC. The motivation behind this choice was the near five fold decrease in expression in comparison to the non-mutated operator.
Notes
Insert
Source
See basic parts for sources of this plasmid