Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Xinyi Liu
Date created: 2016-10-08 11:00:00
Date modified: 2016-10-19 01:16:14
A cyclic promoter of CDK4 from human genome
| Types | DnaRegion |
| Roles | engineered_region Project |
| Sequences | BBa_K1926003_sequence (Version 1) |
Description
This part is a cyclic promoter named CDK4 from human genome. It can lead to transcription of the downstream DNA sequence in every G1 phase[4].4. Guo, Z.Y., et al., The elements of human cyclin D1 promoter and regulation involved. Clin Epigenetics, 2011. 2(2): p. 63-76.
You may use this part to:
1) Express something in mammal cell lines particularly in G1 phases or once in every cell cycle by stable transfecting it into cell line;
2) Use it as a human promoter by transient transfecting it into cells.
Notes
NoneSource
The sequence was retrieved from Addgene. We got it from human genome through PCR using the following primers:pCDK4-F: TGGTGGAGCGAAAAGGTGACAGCATC
pCDK4-R: GCGGAAACTGGGAGGGCGGGGCGAA
(Product: 457)
| Sequence Annotation | Location | Component / Role(s) |
| P CDK4 mutate C into A to remove Pst1 | 65,522 284,284 | promoter feature/promoter feature/mutation sequence_alteration |