Types | DnaRegion
|
Roles | DNA
sequence_feature
|
Description
This is a tandem sequence of lacI binding sites(GAAATGTGAGCGCTCACAACT). In the project "Time bomb" of iGEM Kyoto 2009, this part was used in order to stbilize linear DNA.
It is very difficult to clone this parts because tandem sequence can induce mutation. So, if you want to use this parts, you should cloning this under 32C under which it is liower possible that mutation happens.
Notes
This parts was made by MPR.
Due to mutation, we could not suceed to sequence.
We confirmed this has only one set of EcoR1, Xba1, Spe1 and Pst1 recognition sites.
Source
primer