| Types | DnaRegion
|
| Roles | engineered_region
Composite
|
| Sequences | BBa_K2107010_sequence (Version 1)
|
Description
This Biobrick codes for Platelet Derived Growth Factor-Beta Isoform 1, it is a growth factor that has been shown to modulate cell proliferation in angiogenesis. Additionally, PDGF-B is preceded by the periplasmic localization signal DsbA. When imaging this PDGF-B in western blot it has been shown to appear between 28 and 37Kda. To help with protein purification this part also includes a His tag at the c-terminus.
Notes
When designing this Biobrick we were concerned with the ability of E. coli to correctly fold PDGF-B and form the PDGF-BB dimer because it contains four disulphide bonds. Initially, we decided to include a periplasm localization signal (DsbA) with the part, which cotranslationally translocates PDGF-B into the periplasm. This is important because the periplasm is the most optimized region of the cell for disulphide bond formation, and therefore correct folding. In addition to this we also removed two cysteine residues and replaced them with serines. By doing this we removed one of the disulphide bonds that make up PDGF-BB. Previous research has shown that this method increases the folding efficiency of PDGF-BB while only slightly increasing susceptibility to extreme pH environments.
This part should be cloned into a low to medium copy plasmid and transformed into cells designed for recombinant protein expression such as Origami E. coli.
Source
GAATTCGCGGCCGCTTCTAGAGTAGAGAAAGAGGGGACAAACTAGTATGAAAAAGATTTGGCTGGCGCTGGCTGGTTTAGTTTTAGCGTTTAGCGCATCGGCGAACCGTTGCTGGGCGCTGTTCCTGTCTCTGTGCTGCTACCTGCGTCTGGTTTCTGCGGAAGGTGACCCGATCCCGGAAGAACTGTACGAAATGCTGTCTGACCACTCTATCCGTTCTTTCGACGACCTGCAACGTCTGCTGCACGGTGATCCGGGTGAAGAAGACGGTGCGGAACTGGACCTGAACATGACCCGTTCTCACTCTGGTGGTGAACTGGAATCTCTGGCGCGTGGTCGTCGTTCTCTGGGTTCTCTGACCATCGCGGAACCGGCGATGATCGCGGAATGCAAAACCCGTACCGAAGTTTTCGAAATCTCTCGTCGTCTGATCGACCGTACCAACGCGAACTTCCTGGTTTGGCCGCCGTCTGTTGAAGTTCAGCGTTGCTCTGGTTCTTGCAACAACCGTAACGTTCAGTGCCGTCCGACCCAGGTTCAACTGCGTCCGGTTCAGGTTCGTAAAATCGAAATCGTTCGTAAAAAACCGATCTTCAAAAAAGCGACCGTTACCCTGGAAGACCACCTGGCGTGCAAATGCGAAACCGTTGCGGCGGCGCGTCCGGTTACCCGTTCTCCGGGTGGTTCTCAGGAACAGCGTGCGAAAACCCCGCAGACCCGTGTTACCATCCGTACCGTTCGTGTTCGTCGTCCGCCGAAAGGTAAACACCGTAAATTCAAACACACCCACGACAAAACCGCGCTGAAAGAAACCCTGGGTGCGCATCATCACCATCACCACTAATGATACTAGTAGCGGCCGCTGCAG